И рай стал адом. Чем закончился один из самых страшных экспериментов | Наука | Общество | Аргументы и Факты

Notice: Trying to access array offset on value of type bool in /home/m/menemtpu/pocki.top/public_html/wp-content/themes/root/inc/admin-ad.php on line 49 Notice: Trying to access array offset on value of type bool in /home/m/menemtpu/pocki.top/public_html/wp-content/themes/root/inc/admin-ad.php on line 283 Notice: Trying to access array offset on value of type bool in /home/m/menemtpu/pocki.top/public_html/wp-content/themes/root/inc/admin-ad.php on line 328

В каких случаях необходимо проведение генетической экспертизы митохондриальной днк (мтднк)?

  • для установления родственной связи между двумя женщинами или женщиной и мужчиной у предполагаемых родственников по материнской линии. Например, дед/бабка-внук, дядя/тетя-племянник, брат-сестра;
  • при исследовании крайне малого объема биологического материала. Количество копий мтДНК в одной клетке составляет 100-10 000, в то время как в ядерной ДНК всего лишь по две пары каждой из 23 хромосом;
  • при исследовании образцов десятилетней, столетней и даже тысячелетней давности. Так, например, по мтДНК удалось идентифицировать останки членов российской императорской семьи Романовых.
  • за неимением другого генетического материала. Например, при наличии всего лишь одного волоса. Ствол (стержень) волоса содержит незначительное количество ядерной ДНК, но является хорошим источником митохондриальной ДНК;
  • для определения принадлежности генетического профиля той или иной генеалогической ветви человечества (европейской гаплогруппе, африканской, ближневосточной, американской и т.д.). Таким образом, можно определить происхождение человека.

Генетическая экспертиза митохондриальной днк отвечает на два главных вопроса:

  1. Имеются ли совпадения нуклеотидных последовательностей мтДНК у анализируемых биологических образцов? Для этого по определенным правилам сопоставляют полученные индивидуальные профили полиморфизма анализируемых фрагментов ДНК с целью их отождествления или выявления сходства и различий и установления на этом основании определенных фактов, которые могут иметь доказательственное значение по делу.
  2. Если совпадение признаков установлено, то какова вероятность того, что это совпадение закономерно, а не является случайностью?

Генографический проект

Изучать этногеномику начали в 1980-х годах, когда компьютеры еще не обладали таким быстродействием, а методы анализа ДНК были на несколько порядков медленнее и дороже нынешних. Сейчас самый простой, но достаточно полный анализ индивидуальной молекулярной генеалогии, по 12 маркерам Y-хромосомы, стоит $100−150, а более чем достаточный, по 37 маркерам Y-ДНК полный тест митохондриальной ДНК, — около $400.

Базы данных на десятки тысяч образцов ДНК есть у ряда коммерческих фирм и общественных институтов, и большинство из них (с определенными ограничениями на допуск к персональной информации) открыты для всех. За счет интереса людей к своим индивидуальным родословным информация в этих базах накапливается быстрее, чем ученые успевают ее обработать.

Самое грандиозное из исследований целых популяций — Genographic Project («Генографический проект»), начатый в 2005 году Национальным географическим обществом США (National Geographic Society) при поддержке компании IBM. Цель проекта — за пять лет собрать не менее 100 000 образцов ДНК типичных представителей народов или племен, история которых известна по данным этнографии, истории и археологии, чтобы уточнить пути миграций человечества по Земле.

На самом деле и такая огромная выборка — капля в море по сравнению с реальным разнообразием рас и племен, но по мере добавления информации результаты можно будет уточнять. Даже черновой план, составленный участниками проекта под руководством доктора Спенсера Уэллса, — захватывающее зрелище, особенно в виде интерактивной карты на сайте проекта. Но для начала разберемся с терминами.

Какие материалы необходимо предоставить для проведения генетической экспертизы митохондриальной днк (мтднк)?

Митохондриальная ДНК присутствует во всех клетках организма. Она находится даже в тех клетках организма, в которых отсутствует ядро (тромбоциты, эритроциты, клетки стержня волос и т.д.). Поэтому для получения мтДНК подходят любые ткани организма: кости, зубы, кровь, сперма, фрагменты скелетированных трупов, фрагменты частей тела и многое другое.

Обычно, как и при генетической экспертизе по установлению отцовства или материнства, берутся образцы буккального эпителия (соскоб ватной палочкой с внутренней стороны щеки), кровь из пальца в объеме 0,3-0,5 мл, кровь на ватном диске, волосы или ногти. Взятие образцов тканей осуществляется в соответствии со следующими законами:

  • ст. 35 Федерального закона от 31 мая 2001 г. №73-ФЗ «О государственной судебно-экспертной деятельности в Российской Федерации»;
  • п. 84.4 «Порядок организации и производства судебно-медицинских экспертиз в государственных судебно-экспертных учреждениях Российской Федерации» (Приказ Минздравсоцразвития РФ №346н от 12.05.2020 г.).
ПОДРОБНЕЕ:  Как жителям Московской области получить соцработника - Инструкции и советы - Москва и Подмосковье - РИАМО

Эксперты-генетики после получения биологического материала направляются в специализированную лабораторию, где полученный биоматериал последовательно проходит три этапа исследования: 1) выделение мтДНК; 2) амплифицирование (многократное умножение) определенного локуса мтДНК; 3) определение первичной последовательности нуклеотидов амплифицированного локуса.

На первом этапе эксперт производит выделение ДНК из полученного материала. Выделение митохондриальной ДНК из клеток является очень сложным процессом и в некоторых случаях может продлиться 24 часа. Например, весь процесс выделения митохондриальной ДНК из крови составляет около двух часов, в то время как для того, чтобы только лизировать (разрушить) ткань волоса или ногтя, приходится обрабатывать ее соответствующим ферментом около 12 часов.

На втором этапе анализа производят полимеразно-цепную реакцию (ПЦР-реакцию), в результате которой определенный участок мтДНК (D-петля, или так называемая петля смещения) многократно увеличивается. Именно анализ нуклеотидной последовательности D-петли является дифференцирующим признаком при исследовании мтДНК.

Высокий уровень вариабельности D-петли обусловлен тем, что у разных людей этот участок может иметь разную первичную последовательность нуклеотидов (так называемых «кирпичиков», из которых построена ДНК). В популяции обнаруживается целый набор вариантов, отличающихся друг от друга наличием различных мутаций: точковых нуклеотидных замен, микроделеций и микроинсерций.

На следующем этапе производят очистку амплифицированного участка митохондриальной ДНК и его секвенирование. Секвенирование – это определение первичной последовательности ДНК, иными словами — расшифровка генетического кода, который в принципе уникален для каждого организма.

Сравнивая нуклеотидные последовательности D-петли из разных образцов, эксперт устанавливает степень их соответствия друг другу, а также сравнивает их с референсной последовательностью мтДНК. Расчет несовпадения нуклеотидов (мутаций) ДНК осуществляется согласно ст. 3.

6 Методических указаний Минздрава РФ №2001/4 от 25.01.2001 г. «Применение молекулярно-генетической индивидуализирующей системы на основе полиморфизма нуклеотидных последовательностей митохондриальной ДНК в судебно-медицинской экспертизе идентификации личности и установления биологического родства».

Все результаты тестирования мтДНК сравнивают с так называемой «стандартной кембриджской последовательностью». Это первая нуклеотидная последовательность митохондриальной ДНК, которая была расшифрована. Данная работа была выполнена в 1981 году в Кембридже Стеном Андерсеном, за что последовательность мтДНК получила второе название — «последовательность Андерсена» (в англоязычной литературе).

Поскольку это была первая последовательность мтДНК, ее и взяли за международный стандарт. В настоящее время все мутации в анализируемой последовательности отсчитывают от нее. Сравнивая нуклеотидную последовательность исследуемой мтДНК со стандартной кембриджской последовательностью, устанавливают генетический профиль исследуемой мтДНК, то есть дают ему индивидуальную генетическую характеристику.

По генетическому профилю устанавливают, к какой расе или гаплогруппе относится исследуемая митохондриальная ДНК (и соответственно человек, которому она принадлежит). Следовательно, генетическая экспертиза митохондриальной ДНК позволяет построить ДНК-генеалогию и в определенных случаях предвидеть внешность разыскиваемого человека.

Ключи от генеалогического древа

ДНК представляет собой последовательность нуклеотидов, которые обозначаются буквами G (гуанин), T (тимин), A (аденин) и C (цитозин). Например, фрагмент ДНК может быть вот таким: …GTACAAGAG(TAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA)CTGGTG…

Или вот таким:

…GTACAAGAG(TAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA)CTGGTG…

Обратите внимание на повторяющуюся комбинацию. Это и есть STR (short tandem repeat). Время от времени в «мусорной» части ДНК встречаются вот такие бессмысленные повторения трех-четырех нуклеотидов, в данном случае TAGA (тимин-аденин-гуанин-аденин). Это первый из наиболее часто используемых маркеров Y-хромосомы, DYS19 (DNA Y-chromosome Segment № 19), и приведенные для примера сочетания обозначаются как DYS19=14 и DYS19=15.

ПОДРОБНЕЕ:  Как жителям Московской области получить соцработника - Инструкции и советы - Москва и Подмосковье - РИАМО

Теперь давайте посмотрим на другую последовательность:

…GTACTAGAG (TAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA)CTGGTG…

Это очень похоже на первую последовательность, но в пятом нуклеотиде произошла замена аденина на тимин. Это и есть SNP — одиночный нуклеотидный полиморфизм (single nucleotide polymorphism, «снип») Y-хромосомы. Ключевые «снипы» однозначно определяют гаплогруппу человека, то есть «ветвь» на дереве миграций человечества.

Мальчики и девочки

Начнем с Адама: с мужской молекулярной генеалогией разобраться проще (впрочем, все сказанное ниже о своем происхождении по мужской линии могут узнать и дамы — для этого нужно проанализировать ДНК отца, или брата, или дяди — любого прямого родственника по отцу).

Молекулярная генеалогия

При образовании половых клеток из диплоидных клеток-предшественников их соматические хромосомы (а у женщин — и половые) обмениваются участками — примерно так, как происходит, если не слишком тщательно перетасовать две колоды карт с рубашками разного цвета и снова разложить их на два одинаковых набора независимо от цвета рубашек.

По четверти генома мы получаем от каждого из двух дедушек и двух бабушек, 1/8 — от прадедов и прабабок… В наших хромосомах есть гены не только Адама и Евы, но и всех их близких и дальних родственников, живших 70−80 тысяч лет назад, когда численность нашего вида снизилась до критической величины — примерно 10 000 особей, и более далеких предков, вплоть до первых млекопитающих и даже первых многоклеточных животных.

Но от них мы получили только соматические и X-хромосомы, гены которых в результате постоянного перемешивания расплываются по всей популяции. Почти неизменными из поколения в поколение переходят только Y-хромосома и митохондриальная ДНК. На этом «почти» и основана вся молекулярная генеалогия, изучающая историю по мутациям, произошедшим у предков и сохранившимся в ДНК потомков.

Подгруппа R1a (M17) зародилась в степях на территории нынешней Украины и юга России 10−15 тысяч лет назад. Племена известной по археологическим данным курганной культуры одними из первых приручили лошадь и за счет этого расселились чуть ли не по всему континенту, покорили туземцев, перемешались с ними и навязали им свой язык и религию, ставшие основой протоиндоевропейской (индоарийской) культуры.

К прямым потомкам индоариев относятся 45% мужчин в высших кастах Индии, 40% поляков, северных русских, украинцев, белорусов, латышей и литовцев. Немного реже — южные и западные славяне, исландцы (Рюрик тоже был викингом), восточные немцы и народы России, язык которых относится к финно-угорской группе (тысячелетия соседства давно перемешали «русь, мордву и чудь»).

Несмотря на все смешения племен, носители подгруппы R1a в южнорусских городах составляют 55% мужского населения, а в центральной России — до 70%. Но если кто-нибудь решит на основании принадлежности к этой подгруппе гордиться своей арийской кровью, напоминаем: ваши родственники живут и в пустыне Калахари, и далее по глобусу до Гренландии, Австралии и Огненной Земли.

Мутации: полезные, вредные и нейтральные

Обычно крупные мутации — например, перемещение на другое место, удвоение или, наоборот, выпадение крупного участка хромосомы, несущего один или несколько генов, — не приводят ни к чему хорошему. Как, впрочем, и часто встречающиеся одиночные нуклеотидные полиморфизмы — SNP (см. врезку), если они происходят в пределах одного из 21 000 человеческих генов.

На арене «красавцы»

Последнюю стадию эксперимента Джон Кэлхун назвал «фазой смерти». Исследователь наблюдал появление новой категории самцов, которые получили от него прозвище «красавцы». У них не было ран и шрамов, как не было и желания бороться за самок и территорию. Они избегали конфликтов, не хотели размножаться и как-то участвовать в социальной жизни мышиной колонии, а только целыми днями ели, спали и чистили шёрстку.

Учёные отобрали несколько «красавцев» и самок-отшельниц, поместив их в изолированный загон. Там были воссозданы идеальные условия, как на начальной стадии эксперимента: никаких врагов и много свободного пространства. Но, к удивлению исследователей, поведение мышей не изменилось.

Но вернёмся в основной загон. Из-за высокой смертности молодняка и незначительной доли беременностей популяция стремительно вымирала. И это несмотря на то, что средняя продолжительность жизни подопытных грызунов оказалась значительно выше, чем у их собратьев в дикой природе, а недостатка в корме по-прежнему не было.

ПОДРОБНЕЕ:  Как жителям Московской области получить соцработника - Инструкции и советы - Москва и Подмосковье - РИАМО

В последнем поколении мышей присутствовали исключительно одни «красавцы» и самки-отшельницы. Когда в 1972 г. Джон Кэлхун завершал эксперимент, в «мышином раю» доживали свой век 122 особи, которые давно вышли из детородного возраста. На этом можно было ставить точку: судьба «цивилизации» была предрешена.

Эксперимент «Вселенная-25» (число 25 означало его порядковый номер) привёл Кэлхуна и его ассистентов к парадоксальному выводу: улучшение условий среды обитания вовсе не гарантирует процветания популяции. А при достижении определённой плотности и заполнении всех социальных ролей в обществе непременно возникает прослойка молодых изгоев, число которых постоянно растёт.

Наблюдая за грызунами, Джон Кэлхун придумал новый термин — «поведенческая клоака». Он означает постепенный переход к деструктивному образу жизни в условиях перенаселения. Кроме того, учёный ввёл понятие «двух смертей». Первая — «смерть духа» — наступает при отказе от социальных связей и сложного поведения, когда всё сводится лишь к удовлетворению физиологических потребностей. Вторая — смерть физическая — в такой ситуации становится вопросом недолгого времени.

Получение рентгеновского изображения, конец XIX века.

Размышляя над появлением касты мышей-«красавцев», учёный не удержался от сравнения с человеком. Эволюция приучила его жить в условиях непрестанного давления, стресса и борьбы. Это ключевая черта нашей психики. Но цивилизация и достижения прогресса избавили мужчин от необходимости постоянно бороться за выживание, преодолевать трудности и многочисленные вызовы судьбы.

В итоге они стали инфантильными, способными лишь к рутинным действиям, зато на арену вышли многочисленные «красавцы». Немотивированные вспышки агрессии подростков (пресловутые расстрелы в школах), появление в обществе пар, сознательно отказывающихся от рождения детей (чайлдфри) и процветающая ЛГБТ-пропаганда — всё это можно считать предсказанным в эксперименте Джона Кэлхуна.

Эксперимент подвергался критике. Во-первых, территория «мышиного рая» была ограниченна, подопытные не имели свободы в полном смысле этого слова. Во-вторых, разные биологические виды в аналогичных условиях могут вести себя по-разному: муравьям, пчёлам или голым землекопам скученность не мешает.

Остаётся надеяться, что разум для того и дан человеку, чтобы он стремился в рай и не забрёл ненароком в ад.

Нормативно-правовые документы, определяющие порядок проведения в российской федерации генетической экспертизы митохондриальной днк:

  • Федеральный закон от 31 мая 2001 г. №73-ФЗ «О государственной судебно-экспертной деятельности в Российской Федерации»;
  • Приказ Минздравсоцразвития РФ №346н от 12.05.2020 г. «Об утверждении Порядка организации и производства судебно-медицинских экспертиз»;
  • Методические указания Минздрава РФ №2001/4 от 25.01.2001 г. «Применение молекулярно-генетической индивидуализирующей системы на основе полиморфизма нуклеотидных последовательностей митохондриальной ДНК в судебно-медицинской экспертизе идентификации личности и установления биологического родства»;
  • Семейный кодекс РФ. Глава 10 «Установление происхождения детей».

Откуда в «раю» изгои?

Кэлхуна интересовало, каким станет будущее человеческого общества при повышении уровня жизни, отказе от войн и росте численности населения, который, как ему представлялось, должен напрямую вытекать из комфортных условий. Интерес учёного понятен: в Европе, Северной Америке да и в развивающихся странах в те годы происходил беби-бум.

Свои эксперименты он начал с наблюдений за крысами в естественной среде. Затем построил для них разделённый на отсеки полигон, который назвал «крысиный рай». У его обитателей не было недостатка в пище и воде, отсутствовали враги и прочие угрозы. Тем не менее, достигнув определённой численности, они стали вести себя агрессивно, беспричинно нападать друга на друга и поедать крысят. Самые сильные самцы завели гаремы и изгнали более слабых в центр полигона.

После этого учёный взялся за свой главный эксперимент. Теперь он соорудил «мышиный рай» — загон, состоящий из 256 отсеков, каждый из которых мог вместить 15 мышей. То есть всего 3840 особей. В загоне были автоматические раздатчики еды и воды, материал для строительства гнёзд.

Понравилась статья? Поделиться с друзьями:
Notice: Trying to access array offset on value of type bool in /home/m/menemtpu/pocki.top/public_html/wp-content/themes/root/inc/admin-ad.php on line 379 Notice: Trying to access array offset on value of type bool in /home/m/menemtpu/pocki.top/public_html/wp-content/themes/root/inc/admin-ad.php on line 408
Справочник по болезням человека и животных
Adblock
detector